IthaID: 1320
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 147 (+TA) | HGVS Name: | HBB:c.442_443dupTA |
Hb Name: | Hb Monplaisir | Protein Info: | β 147(+TA); modified C-terminal sequence: (147)Tyr-Lys-Leu-Ala-Phe-Leu-Leu-Ser-Asn-Phe- | Tyr-(158)COOH |
Context nucleotide sequence:
TAATGCCCTGGCCCACAAGTATCACTA [-/TA] AGCTCGCTTTCTTGCTGTCCAAT (Strand: -)
Also known as:
Comments: Found in a heterozygous state in a male subject of Spanish origin with normal haematological parameters. Abnormal haemoglobin (Hb) identified on IEF and CE-HPLC. Normal oxygen affinity and isopropanol stability tests. No Heinz bodies detected on a brilliant cresyl blue preparation. Liquid chromatography MS/MS identified the peptide: the insertion (TA) at the normal stop codon (TAA) leads to a modified C-terminal sequence (147)YKLAFLLSNFY(158)COOH.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Hemoglobinopathy Group: | Structural Haemoglobinopathy |
---|---|
Hemoglobinopathy Subgroup: | β-chain variant |
Allele Phenotype: | N/A |
Stability: | N/A |
Oxygen Affinity: | N/A |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72016 |
Size: | 2 bp |
Located at: | β |
Specific Location: | Exon 3 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Spanish |
Molecular mechanism: | Elongated globin |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Joly P, Lacan P, Bererd M, Garcia C, Zanella-Cleon I, Becchi M, Aubry M, Couprie N, Francina A, Description of two new alpha variants: Hb Canuts [alpha85(F6)Asp-->His (alpha1)] and Hb Ambroise Pare [alpha117(GH5)Phe-->Ile (alpha2)]; two new beta variants: Hb Beaujolais [beta84(EF8)Thr-->Asn] and Hb Monplaisir [beta147 (Tyr-Lys-Leu-Ala-Phe-Phe-Leu-Leu-Ser-Asn-Phe-Tyr-158-COOH)] and one new delta variant: Hb (A2)North Africa [delta59(E3)Lys-->Met]., Hemoglobin, 33(3), 196-205, 2009 PubMed
Created on 2010-06-16 16:13:17,
Last reviewed on 2019-11-12 12:13:09 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:17 | The IthaGenes Curation Team | Created |
2 | 2014-01-09 15:45:42 | The IthaGenes Curation Team | Reviewed. |
3 | 2019-11-12 12:13:09 | The IthaGenes Curation Team | Reviewed. Mutation names, DNA info and Location corrected. Comment added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-30 12:06:09